Gracias Gracias:  0
Página 4 de 8 PrimerPrimer 12345678 ÚltimoÚltimo
Resultados 46 al 60 de 108

Tema: El drama del secuestro y el gobierno Venezolano

  1. #46
    libre pensador Avatar de JEOGIOMAR
    Fecha de ingreso
    Jun 2007
    Mensajes
    1,381

    Re: El drama del secuestro y el gobierno Venezolano

    La editorial Planeta lanzara esta semana el volumen con los relatos del policía que se les voló a las Farc. Lea aquí los detalles sobre el intento de huida de la política secuestrada hace seis años.

    'Fuga de Íngrid y Luis Eladio'

    Después de la fuga de Íngrid y Luis Eladio pude observar cómo eran las tacticas de la guerrilla para localizar a un secuestrado que había emprendido la huida. La noche en que se fugó Íngrid era oscura y lluviosa y los guerrilleros prestaban su turno de guardia, como siempre. El relevante de guardía tenía la misión de pasar revista a sus compañeros, pero se quedaba hablando en los puestos de guardía con los otros guerrilleros y en ese tiempo nos colocaban la cadena en la muñeca.

    A mí me encadenaban al capitan Bermeo. En ocasiones nos podíamos sacar la cadena de la mano, pero en otras nos era imposible, y esa noche era una de esas en que era imposible. Llovía torrencialmente.

    Nos estaban haciendo un encierro con alambre de púas y ya habían construido un pequeño campamento con un tanque de agua que se abastecía con una motobomba y un baño con un sanitario que habían fijado a una base de madera, el cual vaciabamos con un galón de agua que recortaron en la parte superior para mayor comodidad.

    El espacio para secar ropa era muy reducido y dispusieron tablas en el suelo para no caminar por el barro. Las casas estaban unidas unas a otras y en las noches de lluvia nos mojabamos. Ese día que iniciaron el encierro todos nos fuimos a acostar.

    Antes de la instalación del sanitario íbamos a los chontos y a Íngrid le habían hecho uno aparte, cubierto con hojas de palma. El día que estaban entablando ella pidió permiso para ir al chonto y, al mismo tiempo, alias 'Mauricio' o 'Pata Grande' se dirigió hacia el monte. Ella regresó y al rato regresó el guerrillero.

    Como se necesitaban tablas, 'Pata Grande' no encontró otra solución que quitarselas al cambuche de Íngrid, ella le reclamó que por qué tenían que ser esas, que siempre estaban montandosela a ella. Él se enfureció y le dijo que no se la aguantaba más, que fuera a güevoniar al gobierno. Como se exaltó tanto y fue grosero con Íngrid eso llegó a oídos del comandante alias 'Enrique' ¿en la selva todo se escucha a gran distancia¿ quien al momento se acercó y habló con Íngrid.

    Después de este incidente sacaron a 'Pata' del grupo que nos cuidaba, aunque seguía perteneciendo a la compañía de guerrilleros. Con el paso del tiempo, Íngrid me contó el motivo real por el cual 'Pata' se había puesto así ese día y fue que en el momento en que ella se fue para el chonto apareció 'Pata' de entre el monte y se le abalanzó con intenciones de tocarla abusivamente, ella le lanzó una cachetada mientras lograba salir de ese lugar. 'Pata' quedó ofendido y por eso después se portó como un maldito salvaje.

    En ese campamento se hacían simulacros en caso de que llegara un operativo militar para podernos sacar y ponernos fuera del alcance de un rescate. Hicieron un puente a ras del agua de difícil detección que comúnicaba las dos orillas de un caño que desembocaba en el río Vaupés, creo yo.

    Al día siguiente faltaban dos pares de botas, las de Amaón y las de Arteaga, quienes preguntaron por ellas a los guerrilleros. Contestaron que no sabían nada y como los guerrilleros permanecían con las botas dañadas, se pensó que algunos de ellos las habían cogido para ir a pescar, pero nada era claro.

    El sargento Marulanda tenía que entregarle el radio a Íngrid. Fue al cambuche, la llamó, pero no contestó, entonces se lo dejó al lado de la cama. Cuando llegó el desayuno, pusimos la olla para que nos sirvieran y, como siempre, ellos contaron las ollas para que no se quedará nadie sin desayuno.

    Cuando dijeron que hacían falta dos, todos nos preguntamos quién podía faltar, hasta que alguien finalmente dijo: "Faltan los doctores". Fueron a llamarlos para ver si iban a desayunar y la sorpresa fue que no había nadie en ese cambuche. Alertaron a todos los guerrilleros.

    Amaón fue a mirar las botas que estaban en la caleta de Íngrid y, claro, eran las de él, pues la berraca de Íngrid, como sabía que los guerrilleros revisaban las botas, cogió las de Arteaga y Amaón y las puso en su caleta para que cuando alumbraran no sospecharan.

    Recuperaron sus botas, pero para nada... Los guerrilleros siguieron haciendo el encierro del campamento con alambre de púas hasta dejarnos totalmente encerrados. Nos recogieron las botas y andabamos descalzos.

    Les pedíamos a los guerrilleros que nos dijeran la verdad en cuanto a la desaparición de Íngrid ¿en ese tiempo se manejaba la hipótesis de que sería posiblemente liberada¿, que si era que la iban a liberar y nos estaban engañando, y por eso la habían sacado en la noche sin que nos diéramos cuenta, pero ellos decían que no, que ella se había volado.

    Dentro del grupo de secuestrados había unos que deseaban que la volvieran a coger ¿lo que yo más deseaba, en cambio, era que lograra llegar a la libertad¿ por el miedo a las represalias que la guerrilla tomara contra nosotros. A mí lo que me importaba era que alguien saliera libre para poder dar un respiro a esa desesperanza a la que habíamos caído después de no ver una pronta solución a ese problema.

    Entonces los guardias, que prestaban usualmente turnos de dos horas, fueron redoblados y prestaban turnos de seis horas. Quedaron pocos en el campamento, pero ya nos habían encerrado en el cerco de alambre y todo había sido perfectamente diseñado para evitar que nos detectaran. Los demás guerrilleros fueron designados para buscar a Íngrid y a Luis Eladio.

    Primero iniciaron por los alrededores del campamento e hicieron escuadras para hacer un barrido en busca de trillo o rastro. Eran escuadras de diez hombres que cubrían cerca de cinco o seis metros por hombre y cincuenta o sesenta metros a orillas de los caños o ríos.

    También escuchabamos cómo gritaban llamando a Íngrid, pero sin éxito. Veíamos regresar a los guerrilleros, extenuados, después de largas caminatas en busca de aquellos que iban tras su libertad. Cuando salían llevaban solo la ropa puesta y un morralito que ellos denominaban 'minicrucero', donde echaban unas libras de arroz, una olla y no sé qué más cosas que les permitían sobrevivir con lo mínimo.

    En aquel campamento nos visitó el comandante alias 'Arturo', que nos recibió cuando nos entregó alias 'Sombra'. Venía enfermo, con paludismo. Él era un guerrillero negro y alto que operaba en Calamar (Guaviare), pero nos visitó porque también estaba buscando a Íngrid. Revisó el campamento e hizo una observación acerca del tanque del agua porque estaba muy sucio.

    El tanque se abastecía por medio de una motobomba desde un caño que pasaba cerca, era construido en tabla y le colocaban un plástico para que retubiera el agua, pero ese plástico se rompía y constantemente lo teníamos que reparar con una cinta que ellos nos daban.

    Los guerrilleros salían y buscaban a Íngrid, gritaban su nombre pero no obtenían respuesta. Se pasaron a la otra orilla del río, pero tampoco. El guerrillero alias 'Pata Grande' o 'Mauricio' decía «esos deben estar por ahí escondidos, esos no han salido de por aquí». Alias 'el Tigre' estaba de guardía y le pareció escuchar gritos en una dirección, dio la alerta y un grupo de guerrilleros salió hacia alla, pero volvieron a la hora, todos tristes y preocupados, pues ya estaban sentenciados a muerte: se decía que si Íngrid lograba volarse matarían a los responsables de la seguridad.

    Al cabo de cinco días, Castellanos dijo: «Buenos días, doctora, ¿cómo le fue en el paseo? Y como él era gracioso no le creímos, pero al girar la cabeza vimos que venían entrando Luis e Íngrid, totalmente cansados y muy delgados. Les dieron el almuerzo, pero ellos no tenían ganas de comer; después de ese descalabro apenas probaron la comida.

    Llegaron los guerrilleros para encadenarlos ¿era la primera vez que los iban a encadenar¿; primero procedieron con Lucho y luego con Íngrid, pero ella se resistía. Llegó 'Gira', una guerrillera que era la segunda al mando de la compañía que nos cuidaba y cumplía las funciones de enfermera. Íngrid le decía que no permitiera que la encadenaran, que eso era una violación, que ella era mujer y que le ayudara.

    La tenían entre dos guerrilleros, uno era muy pequeño y el otro era el negro 'Efrén'; ella se resistía, pero terminaron por ponerle la cadena a la fuerza. Íngrid le decía a 'Gira' que se le grabara esa imagen porque no la olvidaría nunca, pero la guerrillera le decía "callese que usted no tiene moral" Y le decía eso porque supuestamente fugarse es inmoral para ellos. ¡Qué locura pensar que eso es inmoral! ¿Qué es moral para ellos entonces?
    En ese entonces, antes de la fuga nos habían proporcionado madera para que hiciéramos mesas con unas tablas, y las hicimos. Teníamos una mesa con Lucho e Íngrid para que ella nos enseñara francés. Logré avanzar en lo básico y después de la fuga a ella le prohibieron hablar con todos y permaneció encadenada las 24 horas del día durante muchos meses. Íngrid me enseñó "La Marsellesa", unos cuentos infantiles que me ayudaban a comprender mejor, ya que desde niño uno los sabe en español, un cuento del cuervo y el zorro, y habíamos empezado con un poema, pero todo quedó allí.

    Cuando llegaron nos contaron brevemente lo que había sucedido. El problema fue que Luis Eladio se empezó a sentir mal de salud y lo poquito que llevaron de comida se les terminó, entonces ellos contemplaron la posibilidad de pedir ayuda a algún pescador que pasara por aquel lugar y vieron unos que venían en una canoa.
    Se les ocurrió pedirles ayuda, pero cuando se acercaron se llevaron la sorpresa de que eran guerrilleros. Les dijeron "súbanse, gran 'hp'" y los llevaron al campamento de nuevo. Lucho e Íngrid durante esos días tuvieron un desgaste físico impresionante, llegaron totalmente deteriorados, delgados y demacrados.

    Desbarataron aquel campamento, sacaron el alambre de púas y lo recogieron para llevarlo a otro sitio donde nos construirían un nuevo campamento.
    "muchos hay que no conocen su debilidad, pero otros tantos hay que no conocen su fuerza".

  2. #47
    libre pensador Avatar de JEOGIOMAR
    Fecha de ingreso
    Jun 2007
    Mensajes
    1,381

    Re: El drama del secuestro y el gobierno Venezolano




    Llegó el momento de dejar nuestra indiferencia a un lado.
    Colombianos, Colombianas, y amigos de Colombia en el mundo:

    El próximo 4 de Febrero salgamos a las calles y unamonos en una GRAN MARCHA MUNDIAL EN CONTRA DE LAS FARC.

    Somos muchos más colombianos y colombianas, y amigos de Colombia en todo el mundo quienes construimos patria. El próximo 4 de Febrero a las 12 del mediodía hagamos que escuchen nuestro dolor y el repudio que nos causa la violencia de las FARC, y su actuar terrorista contra Colombia y el mundo.

    - Mostremos nuestra rabia y nuestro dolor.
    - Expresemos que no queremos más el uso de las armas como una expresión de lucha por el poder.
    - Que nos tomen en cuenta.
    - Que somos más los buenos que no somos noticia, y que sea esa la imagen que se vea en los medios de comunicación y que se abran los micrófonos y las páginas de los periódicos y se volteen las cámaras a mirar la cara de cada una y cada uno de los colombianos que si quiere vivir una Colombia en paz y que quiere una Colombia en paz para las próximas generaciones.

    NO IMPORTA EL MUNICIPIO, LA CIUDAD o EL PAIS DONDE TE ENCUENTRES...

    El próximo 4 de Febrero a las 12 del mediodía (hora Bogota) sal a la calle y con banderas de Colombia, con flores, con camisetas blancas, banderas blancas, hazte escuchar, ver, sentir y que te tomen en cuenta.

    Invita a tu familia, a tus hijas e hijos, a tus amigas y amigos, a tus compañeros de trabajo. Invita a la persona que esta a tu lado a hacer un alto en el camino para que las FARC entiendan que NO LOS QUEREMOS.

    Somos muchos más colombianos y colombianas quienes no utilizamos la violencia como una herramienta por el poder.

    ASISTE E INVITA A TODOS TUS AMIGOS Y CONOCIDOS
    CLAMAMOS POR UNA COLOMBIA LIBRE DE LAS FARC



    Para mayor información:
    www.colombiasoyyo.org
    nomasfarccaracas@gmail.com
    Miniaturas adjuntadas Miniaturas adjuntadas El drama del secuestro y el gobierno Venezolano-nomasfarc.png   El drama del secuestro y el gobierno Venezolano-nomasfarc1.png  
    Última edición por JEOGIOMAR; 24-01-2008 a las 21:21
    "muchos hay que no conocen su debilidad, pero otros tantos hay que no conocen su fuerza".

  3. #48
    libre pensador Avatar de JEOGIOMAR
    Fecha de ingreso
    Jun 2007
    Mensajes
    1,381

    Re: El drama del secuestro y el gobierno Venezolano

    hoy 4 de febrero la gente en todo el mundo marcho en contra del secuestro, en contra de las FARC.
    Miniaturas adjuntadas Miniaturas adjuntadas El drama del secuestro y el gobierno Venezolano-c0042.jpg   El drama del secuestro y el gobierno Venezolano-c42.jpg   El drama del secuestro y el gobierno Venezolano-c43.jpg   El drama del secuestro y el gobierno Venezolano-c44.jpg  

    El drama del secuestro y el gobierno Venezolano-c49.jpg   El drama del secuestro y el gobierno Venezolano-c51.jpg   El drama del secuestro y el gobierno Venezolano-c52.jpg   El drama del secuestro y el gobierno Venezolano-c53.jpg  

    El drama del secuestro y el gobierno Venezolano-c59.jpg   El drama del secuestro y el gobierno Venezolano-c56.jpg   El drama del secuestro y el gobierno Venezolano-c55.jpg  
    "muchos hay que no conocen su debilidad, pero otros tantos hay que no conocen su fuerza".

  4. #49
    Lápiz Member Avatar de EdiaN
    Fecha de ingreso
    Jul 2006
    Ubicación
    Chile
    Mensajes
    4,153

    Re: El drama del secuestro y el gobierno Venezolano

    Lo vi en las noticias, y en CNN fue increíble la cantidad de personas que se unieron en pro de un ideal.

    Saludos y ánimos jeogiomar.

  5. #50
    libre pensador Avatar de JEOGIOMAR
    Fecha de ingreso
    Jun 2007
    Mensajes
    1,381

    hoy cumple 6 años secuestrada.

    Ingrid cumple hoy 6 años de secuestro


    SALUD HERNÁNDEZ-MORA
    BOGOTÁ.- Ingrid Betancourt, que este sábado cumple seis años en cautividad, siempre fue polémica. Una política que generaba odios y simpatías casi por igual en su país natal, Colombia, pero una admiración profunda fuera de estas fronteras.
    Como implacable latigo en el Congreso del Gobierno de Ernesto Samper, acusado de llegar al poder con dineros del narcotrafico, ganó infinidad de adeptos y enorme prestigio al punto de llegar después al Senado —la cámara más importante— con el mayor número de votos.
    Con el tiempo, perdió buena parte de su inmenso caudal político. Las diferencias con otras senadoras con las que había formado coalición, sus disparos verbales a diestro y siniestro y las permanentes polémicas que armaba, no siempre comprendidas por el electorado, terminaron por socavar su prestigio en Colombia.
    Por eso, cuando dejó su escaño para concurrir a las presidenciales del 2002, apenas punteaba en las encuestas. Aún así, fiel a su carácter combativo, no bajó la guardía y siguió su campaña como si tuviese un futuro prometedor.
    Incluso su secuestro fue objeto de debate. Unos la acusaron de ser la única culpable del mismo por hacer caso omiso a las advertencias de las autoridades, que consideraban una locura que viajara por una carretera controlada por las Fuerzas Armadas Revolucionarias de Colombia (FARC). Durante los primeros años de su cautividad se lo recordaron con insistencia, y en los sondeos la imagen de Betancourt salía mal parada.
    Fallos de seguridad

    A ese sector le molestó que su familia acusara al entonces presidente, Andrés Pastrana, por no haberla trasladado en helicóptero, cuando en Colombia las leyes son muy claras: ningún mandatario puede prestar ese tipo de servicios a un candidato.
    Con la llegada de las primeras pruebas de vida, Ingrid fue recuperando su popularidad perdida. Su actitud desafiante con la guerrilla e, incluso, la llamada al presidente Álvaro Uribe, que acababa de tomar el mando, para que recurriera al rescate militar, causaron gran admiración. Pero, como dicen en Colombia, para la gente del común, lo que escribía con la mano su familia lo borraba con el codo.
    Yolanda Pulecio, su madre, mujer admirable que dirige desde hace años una casa de acogida para niños de la calle, enfiló sus dardos contra Uribe, señalandole con acritud como el responsable de la suerte de su hija. A las críticas aceradas se sumaba su otra hija, Astrid. La gente les acusaba de que olvidaban a las FARC, como si fuese el Ejecutivo quien mantuviese escondidos en la selva a los rehenes.
    A medida que el tiempo consumía a la ex candidata presidencial en la jungla impenetrable, crecía tanto la desesperación de Yolanda y Astrid como el tono de sus diatribas contra el presidente, el más popular de la historia reciente.
    Menos presencia pública

    La gota que rebasó el vaso para buena parte de los colombianos fue su actitud en la multitudinaria manifestación del pasado 4 de febrero contra las FARC y el secuestro. Astrid adujo que la impresionante protesta fue producto de la manipulación desde el poder y su madre, que estaba entonces en Roma, no sólo secundó esa opinión sino que indicó que pediría al Papa dos milagros: la libertad de su hija y que Uribe dejara la presidencia.
    Además, los jóvenes que organizaron la manifestación en París denunciaron que la familia de Ingrid estaba detrás del cambio repentino del lugar de concentración y del atosigamiento que sufrieron por parte de la Gendarmería francesa.
    Consciente del creciente rechazo que causa en Colombia, la propia Yolanda Pulecio ha anunciado que no volvera a participar en ningún acto público y que sólo siente el respaldo incondicional de Francia. Las críticas no le hacen mella, puesto que su único interés es tener a Ingrid en casa.
    ELMUNDO.ES - DOCUMENTOS -
    Miniaturas adjuntadas Miniaturas adjuntadas El drama del secuestro y el gobierno Venezolano-ingrid.jpg  
    "muchos hay que no conocen su debilidad, pero otros tantos hay que no conocen su fuerza".

  6. #51
    Administrador Avatar de SHAZAM
    Fecha de ingreso
    Apr 2002
    Ubicación
    28.10º N 15.43º W in a blue planet.
    Mensajes
    20,761

    Re: El drama del secuestro y el gobierno Venezolano

    Muere en combate 'Raúl Reyes', el portavoz internacional y número dos de las FARC


    Muere en combate 'Raúl Reyes', el portavoz internacional y número dos de las FARC · ELPAÍS.com

    No se debe uno alegrar de la muerte de nadie... pero como dicen en Venezuela, quien a hierro mata no puede morir a sombrerazos.

    Podran decir lo que quieran sus detractores pero Uribe esta haciendo lo que debe, la única forma de lograr la paz en Colombia es eliminar el terrorismo y sus fuentes.

    ...
    Obtén enseñanza tradicional en arte y cine. Los ordenadores solo son herramientas. Ellos no pueden tomar decisiones creativas, y solo pueden crear trabajos tan buenos como tus conocimientos y tu experiencia les permita.
    Victor Navone


    Ser "animador" es un regalo que te ganas y un honor que deben adjudicarte los otros.
    Chuck Jones


    La tecnología no hace las películas, la gente las hace. No eres un animador sólo porque puedas mover un objeto del punto A al punto B. Eres alguien quien le da vida a un personaje, que es algo que el software y la tecnología no puede dar.
    John Lasseter

  7. #52
    libre pensador Avatar de JEOGIOMAR
    Fecha de ingreso
    Jun 2007
    Mensajes
    1,381

    Re: El drama del secuestro y el gobierno Venezolano

    Cita Iniciado por SHAZAM Ver mensaje
    Muere en combate 'Raúl Reyes', el portavoz internacional y número dos de las FARC


    Muere en combate 'Raúl Reyes', el portavoz internacional y número dos de las FARC · ELPAÍS.com

    No se debe uno alegrar de la muerte de nadie... pero como dicen en Venezuela, quien a hierro mata no puede morir a sombrerazos.

    Podran decir lo que quieran sus detractores pero Uribe esta haciendo lo que debe, la única forma de lograr la paz en Colombia es eliminar el terrorismo y sus fuentes.

    ...
    totalmente de acuerdo, esto es un golpe muy fuerte para las Farc y para el propio Chavez, esta supremamente enojado con el gobierno Colombiano por la muerte de uno de sus camaradas.
    "muchos hay que no conocen su debilidad, pero otros tantos hay que no conocen su fuerza".

  8. #53
    Peligro latente Avatar de Tokego
    Fecha de ingreso
    Jul 2006
    Ubicación
    Santafé de Bogotá
    Mensajes
    156

    Re: El drama del secuestro y el gobierno Venezolano

    Cita Iniciado por JEOGIOMAR Ver mensaje
    totalmente de acuerdo, esto es un golpe muy fuerte para las Farc y para el propio Chavez, esta supremamente enojado con el gobierno Colombiano por la muerte de uno de sus camaradas.
    Aunque la noticia dio mucho fresco para el pueblo Colombiano y mucha furia a Chavez, por desgracia Chavez no es el único enojado:

    "‘Llegaremos hasta las últimas consecuencias’ dijo Correa

    La versión del vecino país del norte sobre lo ocurrido en torno a la muerte del comandante de las FARC, "Raúl Reyes" y otro grupo de guerrilleros no coincidía con los resultados de las primeras investigaciones que ha adelantado el Gobierno por lo que el presidente Correa anunció que Ecuador elevara una protesta enérgica y solicitara una respuesta clara y contundende por parte del Estado colombiano.

    Luego de guardar absoluto silencio durante todo el día de ayer, el mandatario Rafael Correa terminó hablando en la noche sobre los hechos que rodearon la muerte de “Raúl Reyes” (Luis Édgar Devia Silva), miembro del secretariado de las FARC, junto a otros militantes de este grupo, en territorio ecuatoriano, con tono fuerte e indignado.

    Aseguró el presidente Correa que su colega Álvaro Uribe estaba mal informado o que le había mentido de la manera más descaradacuando le llamó en la mañana del sabado.

    Según el ministro de Defensa Juan Manuel Santos, en declaraciones entregadas ayer a la prensa, los combates se dieron en un campamento de las FARC en territorio ecuatoriano “siempre desde territorio colombiano”, sin embargo, los datos con los que contaba el gobierno ecuatoriano al cierre de esta edición no coincidían con lo manifestado por Santos.

    Correa agregó que van a protestar enérgicamente y si no hay una respuesta del vecino país del norte, Ecuador llegara hasta las últimas consecuencias porque no se permitiran más ultrajes al territorio nacional por parte de Colombia.

    Wellington Sandoval, ministro de Defensa nacional afirmó que “este sería el atentado ma grave cometido contra la soberanía del país en lo que va corrido del siglo”.

    Presidente y Ministro hablaron basados en los resultados de las primeras investigaciones realizadas por el país, según las cuales no hubo persecusión en caliente, ni tampoco enfrentamientos, sino que las Fuerzas Armadas de Colombia habrían atacado con tecnología de punta a un campamento de paso armado por guerrilleros de las FARC en Angostura (al norte del país), para pasar la noche.

    Esta conclusión tiene una razón concreta según el gobierno ecuatoriano: los 15 cadáveres que encontraron estaban desnudos y ello es indicio de que descansaban. También hallaron a dos guerrilleras heridas. Al final, el presidente Correa invitó a los medios a sobrevolar la zona de los combates hoy en la mañana.

    De igual manera, anunció el Jefe de Estado ecuatoriano que se había reforzado la seguridad en la frontera con Colombia. (AFP/ PR/ EROI/LMO)"

    Hoy Online, Quito-Ecuador

    Me alegre por un momento con el deceso de Reyes (aunque uno no debe alegrarse con la muerte de nadie), pero ahora ando preocupa'o, las relaciones de Colombia con sus vecinos va de mal en peor, el gobernador de Putumayo pidió al gobierno protección extrema para la población y el presidente Francia dice que no fue muy oportuno; por otro lado me sorprende que medios Colombianos dijeran que Correa daba completo apoyo, cuando este anunciaba investigación, hay que ver este tema con ojo clinico.
    Última edición por Tokego; 02-03-2008 a las 15:47
    La memoria es un perro tonto, le tiras un palo y te trae cualquier cosa

  9. #54
    Administrador Avatar de SHAZAM
    Fecha de ingreso
    Apr 2002
    Ubicación
    28.10º N 15.43º W in a blue planet.
    Mensajes
    20,761

    Re: El drama del secuestro y el gobierno Venezolano

    La actitud de Correa es para congraciarse con Chavez, desde cuando una guerrilla descansa sin guardia, a menos que estos tuviesen permiso del gobierno de Ecuador, entonces si, podríamos decir que los mataron empijamados con los peluches en los brazos. Eso no se lo cree nadie.

    Correa debe tener el mismo cuidado de Chavez para no meter la pata en esta delicada situación o quedaran con el culo al aire en sus romances con las Farc. Ya se están delatando ellos mismos.

    ...
    Obtén enseñanza tradicional en arte y cine. Los ordenadores solo son herramientas. Ellos no pueden tomar decisiones creativas, y solo pueden crear trabajos tan buenos como tus conocimientos y tu experiencia les permita.
    Victor Navone


    Ser "animador" es un regalo que te ganas y un honor que deben adjudicarte los otros.
    Chuck Jones


    La tecnología no hace las películas, la gente las hace. No eres un animador sólo porque puedas mover un objeto del punto A al punto B. Eres alguien quien le da vida a un personaje, que es algo que el software y la tecnología no puede dar.
    John Lasseter

  10. #55
    Senior Member
    Fecha de ingreso
    May 2004
    Ubicación
    Bogota, Colombia
    Mensajes
    481

    Re: El drama del secuestro y el gobierno Venezolano

    Son varios asuntos los que surgen ahora por esta noticia.

    1. Muerte de 'Reyes':
    Me informé lo más que pude al respecto. Definitivamente no hubiera querido estar en los zapatos de ninguno de los combatientes (especialmente los guerrilleros), porque al parecer el ataque fue "high-precision", con bombas clúster. De otra parte, me sentí bastante extraño al percibir una cierta forma de euforia en el cubrimiento de los medios nacionales (no sé si por alegría, o por el simple hecho de que es una noticia de mucho impacto). Como sea, ese señor murió en su ley (como ya lo ha dicho Shazam). Es una verdadera lastima que personas con esa capacidad de liderazgo desperdicien su vida sufriendo ( porque no es que vivan muy tranquilos que digamos...) cuando el mismo esfuerzo y sufrimiento pudiera perfectamente ponerse al servicio de labores verdaderamente loables y altruistas.

    2. Soberanía de Ecuador:
    El cubrimiento de las notas periodísticas fue bastante impreciso (en parte por la rueda de prensa del gobierno colombiano) y eso hizo que la reacción de Correa resultara algo sorpresiva. Como sea, desde el principio me temí que dado el hecho del ingreso de militares colombianos a territorio ecuatoriano seguramente se presentaría algún roce diplomatico.

    3. Chavez y FARC:
    Siempre he tenido la opinión de que Chavez tiene alguna clase de relación con las FARC. No hablo necesariamente de que sean "amigos", pero si de algo como "cada uno por su lado y nos hacemos pasito". Con la declaración que dio respecto de la muerte de 'Reyes', se dedicó exclusivamente a sacar puntos negativos sobre el hecho... mmm... eso deja aún más dudas. Me llamó la atención la forma como aprovechó el presidente Chavez para resaltar que los medios colombianos celebraban "la muerte", pero ellos celebran "la vida". Esto último me hizo recordar unas palabras que me entristecieron mucho: "Patria, socialismo o muerte, lo juro" (BBC Mundo | América Latina | "Patria, socialismo o muerte")

    4. Qué sigue?:
    En general, los analistas concuerdan en que 'Reyes' era de la línea dura de las FARC. Tal vez se presente un replanteo de las políticas de alto nivel del grupo y eso conduzca a que los líderes de línea más política muevan al grupo hacia una decisión firme de negociación (aunque en gobierno de Uribe, lo veo difícil). De todas formas, lo que nadie quiere es que las FARC se resientan y empiecen a efectuar ataques tipo carro-bomba y demás parecidos, Dios quiera que nada de eso pase.

    @Shazam: cuando leí sobre lo de que estaban empiyamados, algo no me sonaba bien, pero no tuve como darle forma a la idea... ahora ya sé que era!

    jedihe
    Cuando traigas un fusil y lo sientes junto a tus ideas, serás irremediablemente seducido por el poder persuasivo de las balas.

    Miscelánea Blender: Blender en español... y bien explicado! (en YouTube o en 3DPoder)

  11. #56
    Administrador Avatar de SHAZAM
    Fecha de ingreso
    Apr 2002
    Ubicación
    28.10º N 15.43º W in a blue planet.
    Mensajes
    20,761

    Re: El drama del secuestro y el gobierno Venezolano

    Cita Iniciado por jedihe Ver mensaje
    @Shazam: cuando leí sobre lo de que estaban empiyamados, algo no me sonaba bien, pero no tuve como darle forma a la idea... ahora ya sé que era!

    jedihe
    Jejeje, se que en esas calidas tierras escriben y pronuncian "piyama", aquí se escribe como en inglés y se pronuncia en absoluto castellano tal cual como se lee: pijama

    Como Spiderman, allí pronunciais "Espaiderman" y aquí "Espiderman" y a cada quien le suena "natural"
    Obtén enseñanza tradicional en arte y cine. Los ordenadores solo son herramientas. Ellos no pueden tomar decisiones creativas, y solo pueden crear trabajos tan buenos como tus conocimientos y tu experiencia les permita.
    Victor Navone


    Ser "animador" es un regalo que te ganas y un honor que deben adjudicarte los otros.
    Chuck Jones


    La tecnología no hace las películas, la gente las hace. No eres un animador sólo porque puedas mover un objeto del punto A al punto B. Eres alguien quien le da vida a un personaje, que es algo que el software y la tecnología no puede dar.
    John Lasseter

  12. #57
    Senior Member
    Fecha de ingreso
    May 2004
    Ubicación
    Bogota, Colombia
    Mensajes
    481

    Re: El drama del secuestro y el gobierno Venezolano

    Hombre, Shazam, me has entendido mal!

    Me refería a lo de que nadie se come el cuento de que combatientes (especialmente de fuerzas irregulares) estén durmiendo desprevenid@s y empiyamad@s (y sigo usando la "y"!!! ).

    jedihe
    Cuando traigas un fusil y lo sientes junto a tus ideas, serás irremediablemente seducido por el poder persuasivo de las balas.

    Miscelánea Blender: Blender en español... y bien explicado! (en YouTube o en 3DPoder)

  13. #58
    Administrador Avatar de SHAZAM
    Fecha de ingreso
    Apr 2002
    Ubicación
    28.10º N 15.43º W in a blue planet.
    Mensajes
    20,761

    Re: El drama del secuestro y el gobierno Venezolano

    Cita Iniciado por jedihe Ver mensaje
    Hombre, Shazam, me has entendido mal!

    Me refería a lo de que nadie se come el cuento de que combatientes (especialmente de fuerzas irregulares) estén durmiendo desprevenid@s y empiyamad@s (y sigo usando la "y"!!! ).

    jedihe
    Jajajaja Mira que lo pensé pero ya le había dado al botón

    Habra que imaginarse un tipo con la trompeta desde un helicóptero tocando la diana... "Venga, señores, a despertarse y darse una ducha rapidito que los vamos a atacar, venga, , último avisooo ¡tacatacatacatacataca! ¡PUM!!!
    Obtén enseñanza tradicional en arte y cine. Los ordenadores solo son herramientas. Ellos no pueden tomar decisiones creativas, y solo pueden crear trabajos tan buenos como tus conocimientos y tu experiencia les permita.
    Victor Navone


    Ser "animador" es un regalo que te ganas y un honor que deben adjudicarte los otros.
    Chuck Jones


    La tecnología no hace las películas, la gente las hace. No eres un animador sólo porque puedas mover un objeto del punto A al punto B. Eres alguien quien le da vida a un personaje, que es algo que el software y la tecnología no puede dar.
    John Lasseter

  14. #59
    Senior Member
    Fecha de ingreso
    May 2004
    Ubicación
    Bogota, Colombia
    Mensajes
    481

    Re: El drama del secuestro y el gobierno Venezolano

    Al leer el último párrafo, me salió una leve risa, pero mi corazón me recordó que todo este asunto es sufrimiento y dolor.... muerte. No lo digo por criticarte, sino para definir mejor mi posición respecto de estas cosas.

    Ahora, algo de actualidad de noticias (SIN orden cronológico):
    - El presidente Correa expulsó al embajador de Colombia en Quito. Ya el sábado había llamado a consultas al suyo propio.
    - Los presidentes Correa y Chavez han ordenado, cada uno por su parte, que se envíen tropas a la frontera (Chavez mandó 10 batallones y tanques y fuerza aérea). Hasta el momento, el cubrimiento noticioso no reporta que esas tropas ya estén haciendo presencia en los lugares que se esperaría. El gobierno colombiano ha decidido que NO enviara tropas a ninguna de las dos fronteras.
    - La cancillería colombiana emitió un comúnicado en el cual pedía disculpas por el ingreso de fuerza militar colombiana a territorio ecuatoriano y declaró que se iba a indemnizar a cualquier ecuatoriano que hubiera podido ser afectado por la acción militar.
    - El comandante general de la policía ha dado dos ruedas de prensa entre ayer y hoy, revelando documentos hallados en uno de los tres computadores encontrados en el campamento de las Farc que fue atacado. SI LOS DOCUMENTOS SON CIERTOS, el presidente Correa estaba adelantando contactos con el secretariado de las Farc para "oficializar" relaciones y el presidente Chavez habría recibido $100.000.000 (US$50.000 al cambio de hoy) cuando estuvo en la carcel y habría financiado recientemente a las Farc con US$300.000.000. El gobierno colombiano esta buscando que expertos efectúen un peritaje a los computadores de los cuales están extrayendo información, con el fin de demostrar que no son pruebas fabricadas. El peritaje sería enviado por la OEA.
    - Según información de medios ecuatorianos una de las guerrilleras heridas que encontraron en el campamento es de origen mexicano.
    - Según analistas colombianos (un académico y un militar), el campamento atacado NO podía ser temporal. El que menos tiempo le otorgó, habló de mínimo 6 meses. Los análisis se hicieron con imágenes de los reportajes efectuados por medios ecuatorianos.
    - Salgo inmediatamente a comprar un router, porque no hay cómo repartir Internet en mi casa!

    ACLARACIÓN: Esta información es lo que he visto EN VARIOS MEDIOS, mayormente de medios habituales. He tratado de leer medios alternativos, pero me canso rápido del habito bastante prevalente de ridiculizar al otro, sin dar mayores datos relevantes.

    jedihe
    Cuando traigas un fusil y lo sientes junto a tus ideas, serás irremediablemente seducido por el poder persuasivo de las balas.

    Miscelánea Blender: Blender en español... y bien explicado! (en YouTube o en 3DPoder)

  15. #60
    libre pensador Avatar de JEOGIOMAR
    Fecha de ingreso
    Jun 2007
    Mensajes
    1,381

    Re: El drama del secuestro y el gobierno Venezolano

    se siguen descubriendo cosas, las fotografías pueden ser muy compremetedoras y apenas están en el primer computador, en este instante el gobierno de Ecuador siguiendo los pasos de Venezuela rompe toda relación con Colombia.
    "muchos hay que no conocen su debilidad, pero otros tantos hay que no conocen su fuerza".

Página 4 de 8 PrimerPrimer 12345678 ÚltimoÚltimo

Temas similares

  1. Secuestro a la diligencia animacion stop motion
    Por Nicolas Nicolas en el foro Cortos de Animación
    Respuestas: 4
    Último mensaje: 11-07-2015, 14:28
  2. Drama de las carreteras
    Por esmarquez en el foro Cortos de Animación
    Respuestas: 0
    Último mensaje: 17-11-2013, 18:44
  3. Latinoamericano Venezolano Presentandose
    Por ProfMatcos en el foro Quien eres tu - Aqui puedes presentarte
    Respuestas: 1
    Último mensaje: 13-09-2013, 19:34
  4. NUEVO VENEZOLaNO
    Por Javo en el foro Trabajos Finalizados
    Respuestas: 5
    Último mensaje: 08-04-2004, 06:48
  5. CHaRaCTER STUDIO DRaMa
    Por duke_24 en el foro Animación y Rigging
    Respuestas: 3
    Último mensaje: 25-10-2003, 18:59

Actualmente estos son sus permisos de publicación en el foro.

  • -No puedes crear nuevos temas al no estar registrado o no haber iniciado sesión en el foro.
  • -No puedes responder temas al no estar registrado o no haber iniciado sesión en el foro.
  • -No puedes subir archivos adjuntos al no estar registrado o no haber iniciado sesión en el foro.
  • -No puedes editar tus mensajes al no estar registrado o no haber iniciado sesión en el foro.
  •